Human ANXA6(Annexin A6) ELISA Kit

Human ANXA6(Annexin A6) ELISA Kit

To Order Contact us:

Human Annexin A6 (ANXA6) ELISA Kit

RDR-ANXA6-Hu-48Tests 48 Tests
EUR 544

Human Annexin A6 (ANXA6) ELISA Kit

RDR-ANXA6-Hu-96Tests 96 Tests
EUR 756

Human Annexin A6 (ANXA6)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A6(ANXA6),partial expressed in E.coli

Human Annexin A6 (ANXA6) ELISA Kit

abx570621-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ANXA6(Annexin A6) ELISA Kit

EH1625 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P08133
  • Alias: ANXA6/Annexin A6/Lipocortin VI/Chromobindin-20/Calphobindin-II/CPB-II/Annexin-6/p70/p68/Protein III/67 kDa calelectrin/Annexin VI/CBP68/Calelectrin/ANX6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Annexin A6, ANXA6 ELISA KIT

ELI-04772h 96 Tests
EUR 824

Human Annexin A6 (ANXA6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ANXA6/ Annexin A6 ELISA Kit

E0163Hu 1 Kit
EUR 571

Human Annexin A6 (ANXA6) ELISA Kit

SEC345Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit

SEC345Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit

SEC345Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit

SEC345Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A6 (ANXA6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A6 (ANXA6) in tissue homogenates, cell lysates and other biological fluids.

Human Annexin A6 (ANXA6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Annexin A6 elisa. Alternative names of the recognized antigen: ANX6
  • ANX-A6
  • CBP68
  • CPB-II
  • Annexin VI
  • 67 kDa calelectrin
  • Calphobindin-II
  • Chromobindin-20
  • Lipocortin VI
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Annexin A6 (ANXA6) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Annexin A6 ELISA Kit (ANXA6)

RK00904 96 Tests
EUR 521

Human Annexin A6(ANXA6)ELISA Kit

QY-E02146 96T
EUR 361

Annexin A6 (ANXA6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx122366-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx159329-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Annexin A6 (ANXA6) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx031169-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx031169-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx330476-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody

abx330534-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Recombinant Annexin A6 (ANXA6)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08133
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: 5.6
Description: Recombinant Human Annexin A6 expressed in: E.coli

Recombinant Annexin A6 (ANXA6)

  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14824
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.3kDa
  • Isoelectric Point: 7.2
Description: Recombinant Mouse Annexin A6 expressed in: E.coli

Cow Annexin A6 (ANXA6) ELISA Kit

abx517019-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Annexin A6 (ANXA6) ELISA Kit

abx517020-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Annexin A6 (ANXA6) ELISA Kit

abx517022-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Annexin A6 (ANXA6) ELISA Kit

abx517023-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Annexin A6, ANXA6 ELISA KIT

ELI-04769c 96 Tests
EUR 928

Bovine Annexin A6, ANXA6 ELISA KIT

ELI-04770b 96 Tests
EUR 928

Rabbit Annexin A6, ANXA6 ELISA KIT

ELI-04771Ra 96 Tests
EUR 928

Mouse Annexin A6, Anxa6 ELISA KIT

ELI-04774m 96 Tests
EUR 865

Human Annexin A6 (ANXA6) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Annexin A6 (ANXA6) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human ANXA6 (Annexin A6)

ELK3041 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Annexin A6 (ANXA6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Annexin A6 (ANX
  • Show more
Description: A sandwich ELISA kit for detection of Annexin A6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Annexin A6 (ANXA6) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A6 (ANXA6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A6 (ANXA6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ANXA6 Annexin A6 Human Recombinant Protein

PROTP08133 Regular: 10ug
EUR 317
Description: ANXA6 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 693 amino acids (1-673 a.a.) and having a molecular mass of 78 kDa._x000D_ ANXA6 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Annexin A6 (ANXA6) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6)

Recombinant Human Annexin A6/ANXA6 (C-6His)

C207-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)

C207-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)

C207-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Annexin A6/ANXA6 (C-6His)

C207-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with APC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with Biotin.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with Cy3.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with FITC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with HRP.

Annexin A6 (ANXA6) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with PE.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6)

Polyclonal ANXA6/Annexin A6/Annexin VI Antibody (aa1-50)

APR02865G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ANXA6/Annexin A6/Annexin VI (aa1-50). This antibody is tested and proven to work in the following applications:

Annexin A6 (ANXA6) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ala2~Ser251)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Annexin A6 (ANXA6). This antibody is labeled with APC-Cy7.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with APC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with Biotin.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with Cy3.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with FITC.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with HRP.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with PE.

Annexin A6 (ANXA6) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANXA6 (Ser251~Leu504)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Annexin A6 (ANXA6). This antibody is labeled with APC-Cy7.

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-100ug

QP8334-ec-100ug 100ug
EUR 408

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-10ug

QP8334-ec-10ug 10ug
EUR 200

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-1mg

QP8334-ec-1mg 1mg
EUR 1632

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-200ug

QP8334-ec-200ug 200ug
EUR 634

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-500ug

QP8334-ec-500ug 500ug
EUR 1060

Recombinant Human ANXA6/ Annexin A6/ Annexin6 Protein, GST, E.coli-50ug

QP8334-ec-50ug 50ug
EUR 263

Annexin A6

PR27215 2 ug
EUR 191

Annexin A6 Cell ELISA Kit

abx595033-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Recombinant Human Annexin A6

7-04336 2µg Ask for price

Recombinant Human Annexin A6

7-04337 10µg Ask for price

Recombinant Human Annexin A6

7-04338 1mg Ask for price

Annexin A6 Antibody

AF0116 200ul
EUR 304
Description: Annexin A6 antibody detects endogenous levels of total Annexin A6.

Annexin A6 Antibody

ABF0116 100 ug
EUR 438

Annexin A6 Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Annexin A6 antibody

70R-49371 100 ul
EUR 244
Description: Purified Polyclonal Annexin A6 antibody

Annexin A6 antibody

70R-31098 100 ug
EUR 327
Description: Rabbit polyclonal Annexin A6 antibody

Annexin A6 Antibody

33322-100ul 100ul
EUR 252

Annexin A6 Antibody

33322-50ul 50ul
EUR 187

Annexin A6 antibody

70R-13975 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Annexin A6 antibody

Annexin A6 antibody

70R-1672 100 ug
EUR 377
Description: Rabbit polyclonal Annexin A6 antibody raised against the C terminal of ANXA6

Annexin A6 antibody

70R-1673 100 ug
EUR 377
Description: Rabbit polyclonal Annexin A6 antibody raised against the N terminal of ANXA6

Annexin VI (ANXA6) Antibody

abx037409-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Annexin VI (ANXA6) Antibody

abx230438-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Annexin VI/ANXA6 Antibody

A03735 100ug/vial
EUR 334

Anti-Annexin VI/ANXA6 Antibody

PA1436 100ug/vial
EUR 334

Polyclonal Annexin A6 Antibody

APR05492G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Annexin A6 . This antibody is tested and proven to work in the following applications:

Annexin A6 Conjugated Antibody

C33322 100ul
EUR 397

Annexin A6 Blocking Peptide

AF0116-BP 1mg
EUR 195

Annexin A6 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Annexin A6 Blocking Peptide

33R-8376 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ANXA6 antibody, catalog no. 70R-1672

Annexin A6 Polyclonal Antibody

42163-100ul 100ul
EUR 333

Annexin A6 Colorimetric Cell-Based ELISA Kit

EKC1030 100ul
EUR 572

Anxa6/ Rat Anxa6 ELISA Kit

ELI-04773r 96 Tests
EUR 886

Annexin A6 protein (His tag)

80R-1242 50 ug
EUR 397
Description: Purified recombinant Human Annexin A6 protein


ELA-E1458h 96 Tests
EUR 824


EF003038 96 Tests
EUR 689

Carboxypeptidase A6 ELISA KIT|Human

EF008385 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Carboxypeptidase A6(CPA6) ELISA kit

E01C1994-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit

E01C1994-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxypeptidase A6(CPA6) ELISA kit

E01C1994-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Serpin A6 PicoKine ELISA Kit

EK1963 96 wells
EUR 425
Description: For quantitative detection of human Serpin A6 in cell culture supernates, serum and plasma (heparin, EDTA) and urine.

Human Carboxypeptidase A6, CPA6 ELISA KIT

ELI-25531h 96 Tests
EUR 824

Human Ribonuclease A6 (RNASE6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Carboxypeptidase A6 (CPA6) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Golgin A6 (GOLGA6)ELISA Kit

201-12-2731 96 tests
EUR 440
  • This Golgin A6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

EUR 517
  • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

EUR 673
  • Should the Human Ribonuclease A6 (RNASE6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ribonuclease A6 ELISA Kit (RNASE6)

RK02202 96 Tests
EUR 521

Human Ribonuclease A6 (RNASE6) ELISA Kit

RD-RNASE6-Hu-48Tests 48 Tests
EUR 521

Human Ribonuclease A6 (RNASE6) ELISA Kit

RD-RNASE6-Hu-96Tests 96 Tests
EUR 723

Human Ribonuclease A6 (RNASE6) ELISA Kit

RDR-RNASE6-Hu-48Tests 48 Tests
EUR 544

Human Ribonuclease A6 (RNASE6) ELISA Kit

RDR-RNASE6-Hu-96Tests 96 Tests
EUR 756

Human Carboxypeptidase A6(CPA6)ELISA Kit

QY-E01346 96T
EUR 361

Human Ribonuclease A6(RNASE6)ELISA Kit

QY-E03170 96T
EUR 361

Human Golgin A6(GOLGA6)ELISA Kit

QY-E03373 96T
EUR 361

Human Ribonuclease A6 (RNASE6) ELISA Kit

SED192Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

SED192Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

SED192Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

SED192Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ribonuclease A6 (RNASE6) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ribonuclease A6 (RNASE6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Ribonuclease A6 (RNASE6) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ribonuclease A6 elisa. Alternative names of the recognized antigen: RNS6
  • Rnase-A6
  • RNase K6
  • Ribonuclease, RNase A Family, K6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ribonuclease A6 (RNASE6) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ANXA6 antibody

10R-10668 100 ug
EUR 381
Description: Mouse monoclonal ANXA6 antibody

ANXA6 Antibody

31030-100ul 100ul
EUR 252

ANXA6 Antibody

31030-50ul 50ul
EUR 187

ANXA6 Antibody

32824-100ul 100ul
EUR 252

Anxa6 antibody

20R-1257 100 ug
EUR 377
Description: Rabbit polyclonal Anxa6 antibody

ANXA6 antibody

70R-15739 50 ul
EUR 435
Description: Rabbit polyclonal ANXA6 antibody

ANXA6 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ANXA6 Antibody

CSB-PA904851-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

ANXA6 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ANXA6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

ANXA6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ANXA6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ANXA6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:500, IHC:1:25-1:100

ANXA6 Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ANXA6 Antibody

CSB-PA153225-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ANXA6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ANXA6. Recognizes ANXA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:500, IHC:1:25-1:100

Human ANXA6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ANXA6 Recombinant Protein (Human)

RP001378 100 ug Ask for price

Human Annexin 2 ELISA kit

E01A0055-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin 2 ELISA kit

E01A0055-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit

E01A0208-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit

E01A0208-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit

E01A0209-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit

E01A0209-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A7 ELISA kit

E01A0210-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A7 ELISA kit

E01A0210-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit

E01A0593-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit

E01A0593-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin V ELISA kit

E01A0593-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin V in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit

E01A0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit

E01A0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A2 ELISA kit

E01A0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Annexin A10 ELISA KIT|Human

EF007784 96 Tests
EUR 689

Annexin A11 ELISA KIT|Human

EF007785 96 Tests
EUR 689

Annexin A13 ELISA KIT|Human

EF007786 96 Tests
EUR 689

Annexin VII ELISA KIT|Human

EF007788 96 Tests
EUR 689

Annexin VIII ELISA KIT|Human

EF007789 96 Tests
EUR 689

Human Annexin ?,ANX-? ELISA Kit

201-12-1108 96 tests
EUR 440
  • This Annexin ? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human Protein S100-A6

EK3954 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein S100-A6 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human S100A6/ Protein S100-A6 ELISA Kit

E2196Hu 1 Kit
EUR 571

Human S100A6(Protein S100-A6) ELISA Kit

EH1923 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: P06703
  • Alias: S100A6/S100 Calcium Binding Protein A6/CACY/MLN 4/PRA/2A9/CABP/CACY5B10/Calcyclin/Growth factor-inducible protein 2A9/PRAS100 calcium binding protein A6/Prolactin receptor-associated protein/
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Protein S100- A6, S100A6 ELISA KIT

ELI-05741h 96 Tests
EUR 824

ELISA kit for Human RNASE6 (Ribonuclease A6)

ELK4520 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ribonuclease A6 (RNASE6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ribonucle
  • Show more
Description: A sandwich ELISA kit for detection of Ribonuclease A6 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protocadherin gamma- A6, PCDHGA6 ELISA KIT

ELI-35636h 96 Tests
EUR 824

Human Protein S100-A6 (S100A6) ELISA Kit

abx251242-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human EPH Receptor A6 (EPHA6) ELISA Kit

abx387162-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Annexin V ELISA kit

55R-IB49646 96 wells
EUR 1178
Description: ELISA kit for the detection of Annexin V in the research laboratory

Annexin V ELISA kit

55R-ORG643 96 wells
EUR 451
Description: ELISA kit for the detection of Annexin V in the research laboratory

ANXA6 Conjugated Antibody

C32824 100ul
EUR 397

ANXA6 Conjugated Antibody

C31030 100ul
EUR 397

ANXA6 Polyclonal Antibody

A53041 100 µg
EUR 570.55
Description: Ask the seller for details

ANXA6 Rabbit pAb

A5390-100ul 100 ul
EUR 308

ANXA6 Rabbit pAb

A5390-200ul 200 ul
EUR 459

ANXA6 Rabbit pAb

A5390-20ul 20 ul
EUR 183

ANXA6 Rabbit pAb

A5390-50ul 50 ul
EUR 223

Anxa6 Blocking Peptide

33R-5065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Anxa6 antibody, catalog no. 20R-1257

ANXA6 cloning plasmid

CSB-CL001847HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atggccaaaccagcacagggtgccaagtaccggggctccatccatgacttcccaggctttgaccccaaccaggatgccgaggctctgtacactgccatgaagggctttggcagtgacaaggaggccatactggacataatcacctcacggagcaacaggcagaggcaggaggtct
  • Show more
Description: A cloning plasmid for the ANXA6 gene.


PVT13946 2 ug
EUR 391

Anti-ANXA6 Antibody

STJ500096 100 µg
EUR 476

Anti-ANXA6 antibody

STJ11100042 100 µl
EUR 413
Description: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described.

Anti-ANXA6 antibody

STJ27343 100 µl
EUR 277
Description: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described.

Goat Carboxypeptidase A6(CPA6) ELISA kit

E06C1994-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase A6(CPA6) ELISA kit

E06C1994-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxypeptidase A6(CPA6) ELISA kit

E06C1994-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A6(CPA6) ELISA kit

E02C1994-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A6(CPA6) ELISA kit

E02C1994-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxypeptidase A6(CPA6) ELISA kit

E02C1994-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit

E03C1994-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit

E03C1994-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxypeptidase A6(CPA6) ELISA kit

E03C1994-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxypeptidase A6(CPA6) ELISA kit

E04C1994-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.