Human DCD(Dermcidin) ELISA Kit
To Order Contact us: Yamada@jsce-ip.com
 ELISA Kit) Human Dermcidin (DCD) ELISA Kit |
|
RDR-DCD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dermcidin (DCD) ELISA Kit |
|
RDR-DCD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dermcidin (DCD) ELISA Kit |
|
RD-DCD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dermcidin (DCD) ELISA Kit |
|
RD-DCD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 ELISA Kit) Rat Dermcidin (DCD) ELISA Kit |
|
DLR-DCD-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
DLR-DCD-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
RDR-DCD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Dermcidin (DCD) ELISA Kit |
|
RDR-DCD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Rat Dermcidin (DCD) ELISA Kit |
|
RD-DCD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Dermcidin (DCD) ELISA Kit |
|
RD-DCD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Dermcidin (DCD) ELISA Kit |
|
20-abx151294 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Dermcidin (DCD) ELISA Kit |
|
abx257296-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Dermcidin (DCD) ELISA Kit |
|
SEC896Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
|
SEC896Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
|
SEC896Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
|
SEC896Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Dermcidin (DCD) ELISA Kit |
|
4-SEC896Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
- AIDD
- DCD1
- DSEP
- PIF
- Proteolysis Inducing Factor
- Preproteolysin
- Diffusible Survival/Evasion Peptide
- Survival Promoting Peptide
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) Human Dermcidin ELISA Kit (DCD) |
|
RK01249 |
Abclonal |
96 Tests |
EUR 521 |
) Human Dermcidin (DCD) |
|
1-CSB-YP006537HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 11.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Dermcidin(DCD) expressed in Yeast |
Human Dermcidin (DCD) |
|
1-CSB-EP006537HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli |
Human Dermcidin (DCD) |
|
1-CSB-EP006537HUa6 |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 23.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli |
Rat Dermcidin (DCD) ELISA Kit |
|
20-abx155435 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Dermcidin (DCD) ELISA Kit |
|
SEC896Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
SEC896Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
SEC896Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
SEC896Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Dermcidin (DCD) ELISA Kit |
|
4-SEC896Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
- AIDD
- DCD1
- DSEP
- PIF
- Proteolysis Inducing Factor
- Preproteolysin
- Diffusible Survival/Evasion Peptide
- Survival Promoting Peptide
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) Rat Dermcidin ELISA Kit (DCD) |
|
RK03614 |
Abclonal |
96 Tests |
EUR 521 |
) ELISA kit for Human DCD (Dermcidin) |
|
ELK2908 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
- Show more
|
|
Description: A sandwich ELISA kit for detection of Dermcidin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Antibody) Dermcidin (DCD) Antibody |
|
20-abx109721 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
|
20-abx141389 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
|
20-abx100245 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dermcidin (DCD) Antibody |
|
abx032955-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
|
abx032955-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
|
20-abx005487 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody |
|
20-abx172090 |
Abbexa |
|
|
|
|
Dermcidin (DCD) Antibody |
|
20-abx172091 |
Abbexa |
|
|
|
|
Dermcidin (DCD) Antibody |
|
20-abx176148 |
Abbexa |
|
|
|
|
Dermcidin (DCD) Antibody |
|
abx232263-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
) Recombinant Dermcidin (DCD) |
|
4-RPC896Hu01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P81605
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 11.0kDa
- Isoelectric Point: 6.2
|
|
Description: Recombinant Human Dermcidin expressed in: E.coli |
 CLIA Kit) Human Dermcidin (DCD) CLIA Kit |
|
20-abx493964 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Human Dermcidin (DCD) Protein |
|
20-abx066308 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
) ELISA kit for Rat DCD (Dermcidin) |
|
ELK6013 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
- Show more
|
|
Description: A sandwich ELISA kit for detection of Dermcidin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 CLIA Kit) Rat Dermcidin (DCD) CLIA Kit |
|
20-abx493965 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Rat Dermcidin (DCD) Protein |
|
20-abx653162 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Antibody (HRP)) Dermcidin (DCD) Antibody (HRP) |
|
20-abx108177 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Dermcidin (DCD) Antibody (Biotin) |
|
20-abx105339 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Dermcidin (DCD) Antibody (FITC) |
|
20-abx106758 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dermcidin (DCD) Antibody (Biotin) |
|
20-abx272301 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Polyclonal Antibody (Human)) Dermcidin (DCD) Polyclonal Antibody (Human) |
|
4-PAC896Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD) |
 Polyclonal Antibody (Human), APC) Dermcidin (DCD) Polyclonal Antibody (Human), APC |
|
4-PAC896Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Dermcidin (DCD) Polyclonal Antibody (Human), Biotinylated |
|
4-PAC896Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Dermcidin (DCD) Polyclonal Antibody (Human), Cy3 |
|
4-PAC896Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Dermcidin (DCD) Polyclonal Antibody (Human), FITC |
|
4-PAC896Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Dermcidin (DCD) Polyclonal Antibody (Human), HRP |
|
4-PAC896Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Dermcidin (DCD) Polyclonal Antibody (Human), PE |
|
4-PAC896Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with PE. |
 ELISA Kit) Human PIF/DCD(Proteolysis Inducing Factor/Dermcidin) ELISA Kit |
|
EH4251 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P81605
- Alias: AIDD, DCD-1, DSEP, HCAP, MGC71930, PIF, diffusible survival/evasion peptide|preproteolysin|proteolysis inducing factor|survival promoting peptide
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
ELISA Kit) Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit |
|
CSB-E13626h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit |
|
1-CSB-E13626h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 Polyclonal Antibody (Human), APC-Cy7) Dermcidin (DCD) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAC896Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DCD (Cys18~Leu110)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC-Cy7. |
) ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
|
KTE62411-48T |
Abbkine |
48T |
EUR 354 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
|
KTE62411-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) |
|
KTE62411-96T |
Abbkine |
96T |
EUR 572 |
- Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-100ug |
|
QP5914-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-10ug |
|
QP5914-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-1mg |
|
QP5914-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-200ug |
|
QP5914-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-500ug |
|
QP5914-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
 Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-50ug |
|
QP5914-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-100ug |
|
QP5914-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-10ug |
|
QP5914-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-1mg |
|
QP5914-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-200ug |
|
QP5914-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-500ug |
|
QP5914-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
 Recombinant Human Dermcidin/ DCD Protein, His, Yeast-50ug |
|
QP5914-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
 Dermcidin |
|
D077-5MG |
TOKU-E |
5mg |
EUR 349 |
) Dermcidin-1L (human) |
|
H-7316.0500 |
Bachem |
0.5mg |
EUR 177 |
|
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net |
Dermcidin-1L (human) |
|
H-7316.1000 |
Bachem |
1.0mg |
EUR 294 |
|
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 DCD siRNA |
|
20-abx913661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 DCD Antibody |
|
47246-100ul |
SAB |
100ul |
EUR 252 |
DCD Antibody |
|
1-CSB-PA006537DA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
 Human DCD shRNA Plasmid |
|
20-abx964554 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DCD Recombinant Protein (Human) |
|
RP008806 |
ABM |
100 ug |
Ask for price |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 DCD Conjugated Antibody |
|
C47246 |
SAB |
100ul |
EUR 397 |
 DCD cloning plasmid |
|
CSB-CL006537HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaag
- Show more
|
|
Description: A cloning plasmid for the DCD gene. |
 anti- DCD antibody |
|
FNab02263 |
FN Test |
100µg |
EUR 585 |
- Immunogen: dermcidin
- Uniprot ID: P81605
- Gene ID: 117159
- Research Area: Immunology
|
|
Description: Antibody raised against DCD |
 DCD Polyclonal Antibody |
|
A53288 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 DCD Rabbit pAb |
|
A7280-100ul |
Abclonal |
100 ul |
EUR 308 |
DCD Rabbit pAb |
|
A7280-200ul |
Abclonal |
200 ul |
EUR 459 |
DCD Rabbit pAb |
|
A7280-20ul |
Abclonal |
20 ul |
EUR 183 |
DCD Rabbit pAb |
|
A7280-50ul |
Abclonal |
50 ul |
EUR 223 |
 Anti-DCD antibody |
|
STJ29419 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 (pORF)) DCD ORF Vector (Human) (pORF) |
|
ORF002936 |
ABM |
1.0 ug DNA |
EUR 95 |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 DCD Antibody, HRP conjugated |
|
1-CSB-PA006537DB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DCD Antibody, FITC conjugated |
|
1-CSB-PA006537DC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DCD Antibody, Biotin conjugated |
|
1-CSB-PA006537DD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) DCD sgRNA CRISPR Lentivector set (Human) |
|
K0564501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 (Target 1)) DCD sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0564502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DCD sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0564503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DCD sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0564504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DCD Protein Vector (Human) (pPB-C-His) |
|
PV011741 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DCD Protein Vector (Human) (pPB-N-His) |
|
PV011742 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DCD Protein Vector (Human) (pPM-C-HA) |
|
PV011743 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DCD Protein Vector (Human) (pPM-C-His) |
|
PV011744 |
ABM |
500 ng |
EUR 329 |
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
) Polyclonal DCD Antibody (C-term) |
|
APR10835G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCD (C-term). This antibody is tested and proven to work in the following applications: |
 DCD Polyclonal Antibody, Biotin Conjugated |
|
A53285 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 DCD Polyclonal Antibody, FITC Conjugated |
|
A53286 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 DCD Polyclonal Antibody, HRP Conjugated |
|
A53287 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Recombinant Aeromonas Hydrophila dcd Protein |
|
VAng-Lsx0888-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3630 |
|
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Aeromonas Hydrophila dcd Protein |
|
VAng-Lsx0888-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2460 |
|
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Aeromonas Hydrophila dcd Protein |
|
VAng-Lsx0888-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1676 |
|
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein. |
 Recombinant Aeromonas Salmonicida dcd Protein |
|
VAng-Lsx1258-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3630 |
|
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Aeromonas Salmonicida dcd Protein |
|
VAng-Lsx1258-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2460 |
|
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Aeromonas Salmonicida dcd Protein |
|
VAng-Lsx1258-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1676 |
|
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein. |
 vWF Acty. Kit |
|
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
 vWF Ant. Kit |
|
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
) hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
|
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
|
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 PrecisionX Multiplex gRNA Cloning Kit |
|
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
|
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
 DCD 3'UTR Luciferase Stable Cell Line |
|
TU005610 |
ABM |
1.0 ml |
EUR 1394 |
 DCD 3'UTR GFP Stable Cell Line |
|
TU055610 |
ABM |
1.0 ml |
EUR 1394 |
) DCD sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K0564505 |
ABM |
3 x 1.0 ug |
EUR 376 |
) CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
|
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
) Recombinant Pasteurella Multocida dcd Protein (aa 1-194) |
|
VAng-Cr6769-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3432 |
|
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Pasteurella Multocida dcd Protein (aa 1-194) |
|
VAng-Cr6769-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2456 |
|
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Pasteurella Multocida dcd Protein (aa 1-194) |
|
VAng-Cr6769-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1673 |
|
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Clostridium Thermocellum dcd Protein (aa 1-178) |
|
VAng-Lsx01921-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3338 |
|
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Clostridium Thermocellum dcd Protein (aa 1-178) |
|
VAng-Lsx01921-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2548 |
|
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Clostridium Thermocellum dcd Protein (aa 1-178) |
|
VAng-Lsx01921-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1630 |
|
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Mycobacterium Paratuberculosis dcd Protein (aa 1-190) |
|
VAng-Yyj0846-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Mycobacterium Paratuberculosis Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Mycobacterium Avium dcd Protein（aa 1-190) |
|
VAng-Yyj1176-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193) |
|
VAng-Cr1804-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3420 |
|
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193) |
|
VAng-Cr1804-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2449 |
|
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193) |
|
VAng-Cr1804-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1676 |
|
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Mycobacterium Leprae dcd Protein (aa 1-190) |
|
VAng-Yyj1902-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3396 |
|
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Mycobacterium Leprae dcd Protein (aa 1-190) |
|
VAng-Yyj1902-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Mycobacterium Leprae dcd Protein (aa 1-190) |
|
VAng-Yyj1902-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Mycobacterium Avium dcd Protein (aa 1-190) |
|
VAng-Yyj2512-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3420 |
|
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Mycobacterium Avium dcd Protein (aa 1-190) |
|
VAng-Yyj2512-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2437 |
|
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Mycobacterium Avium dcd Protein (aa 1-190) |
|
VAng-Yyj2512-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193) |
|
VAng-Cr4744-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3432 |
|
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193) |
|
VAng-Cr4744-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2456 |
|
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193) |
|
VAng-Cr4744-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1673 |
|
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein. |
) Recombinant Shigella Sonnei dcd Protein (aa 1-193) |
|
VAng-Lsx09626-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3652 |
|
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Shigella Sonnei dcd Protein (aa 1-193) |
|
VAng-Lsx09626-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2456 |
|
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Shigella Sonnei dcd Protein (aa 1-193) |
|
VAng-Lsx09626-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1673 |
|
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Campylobacter Concisus dcd Protein (aa 1-186) |
|
VAng-Lsx5791-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Concisus dcd Protein (aa 1-186) |
|
VAng-Lsx5791-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Concisus dcd Protein (aa 1-186) |
|
VAng-Lsx5791-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Campylobacter Curvus dcd Protein (aa 1-186) |
|
VAng-Lsx5944-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Curvus dcd Protein (aa 1-186) |
|
VAng-Lsx5944-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Curvus dcd Protein (aa 1-186) |
|
VAng-Lsx5944-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Campylobacter Fetus dcd Protein (aa 1-186) |
|
VAng-Lsx6078-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Fetus dcd Protein (aa 1-186) |
|
VAng-Lsx6078-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Fetus dcd Protein (aa 1-186) |
|
VAng-Lsx6078-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Campylobacter Jejuni dcd Protein (aa 1-186) |
|
VAng-Lsx6229-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Jejuni dcd Protein (aa 1-186) |
|
VAng-Lsx6229-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Campylobacter Jejuni dcd Protein (aa 1-186) |
|
VAng-Lsx6229-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Bordetella Avium dcd Protein (aa 1-187) |
|
VAng-Lsx4252-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Bordetella Avium dcd Protein (aa 1-187) |
|
VAng-Lsx4252-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Bordetella Avium dcd Protein (aa 1-187) |
|
VAng-Lsx4252-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Helicobacter Pylori dcd Protein (aa 1-188) |
|
VAng-Lsx3399-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein. |
Recombinant Helicobacter Pylori dcd Protein (aa 1-188) |
|
VAng-Lsx3399-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein. |
Recombinant Helicobacter Pylori dcd Protein (aa 1-188) |
|
VAng-Lsx3399-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein. |
) Recombinant Legionella Pneumophila dcd Protein (aa 1-188) |
|
VAng-Lsx3850-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3572 |
|
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Legionella Pneumophila dcd Protein (aa 1-188) |
|
VAng-Lsx3850-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2425 |
|
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Legionella Pneumophila dcd Protein (aa 1-188) |
|
VAng-Lsx3850-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1653 |
|
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173) |
|
VAng-Lsx7545-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3525 |
|
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173) |
|
VAng-Lsx7545-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2548 |
|
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173) |
|
VAng-Lsx7545-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1630 |
|
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein. |
) Recombinant Shigella Dysenteriae dcd Protein (aa 1-193) |
|
VAng-Lsx06819-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3432 |
|
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Deoxycytidine triphosphate deaminase, recombinant protein. |
Recombinant Shigella Dysenteriae dcd Protein (aa 1-193) |
|
VAng-Lsx06819-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2456 |
|
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Deoxycytidine triphosphate deaminase, recombinant protein. |
