Human DCD(Dermcidin) ELISA Kit

Human DCD(Dermcidin) ELISA Kit

To Order Contact us:  Yamada@jsce-ip.com

Human Dermcidin (DCD) ELISA Kit

RDR-DCD-Hu-48Tests 48 Tests
EUR 544

Human Dermcidin (DCD) ELISA Kit

RDR-DCD-Hu-96Tests 96 Tests
EUR 756

Human Dermcidin (DCD) ELISA Kit

RD-DCD-Hu-48Tests 48 Tests
EUR 521

Human Dermcidin (DCD) ELISA Kit

RD-DCD-Hu-96Tests 96 Tests
EUR 723

Rat Dermcidin (DCD) ELISA Kit

DLR-DCD-Ra-48T 48T
EUR 549
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

DLR-DCD-Ra-96T 96T
EUR 718
  • Should the Rat Dermcidin (DCD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Dermcidin (DCD) in samples from tissue homogenates or other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

RDR-DCD-Ra-48Tests 48 Tests
EUR 583

Rat Dermcidin (DCD) ELISA Kit

RDR-DCD-Ra-96Tests 96 Tests
EUR 811

Rat Dermcidin (DCD) ELISA Kit

RD-DCD-Ra-48Tests 48 Tests
EUR 557

Rat Dermcidin (DCD) ELISA Kit

RD-DCD-Ra-96Tests 96 Tests
EUR 775

Human Dermcidin, DCD ELISA KIT

ELI-28148h 96 Tests
EUR 824

Human Dermcidin (DCD) ELISA Kit

20-abx151294
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermcidin (DCD) ELISA Kit

abx257296-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

SEC896Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Dermcidin (DCD) ELISA Kit

4-SEC896Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Dermcidin ELISA Kit (DCD)

RK01249 96 Tests
EUR 521

Human Dermcidin (DCD)

1-CSB-YP006537HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in Yeast

Human Dermcidin (DCD)

1-CSB-EP006537HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Human Dermcidin (DCD)

1-CSB-EP006537HUa6
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dermcidin(DCD) expressed in E.coli

Rat Dermcidin (DCD) ELISA Kit

20-abx155435
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

SEC896Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Dermcidin (DCD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Dermcidin (DCD) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Dermcidin (DCD) ELISA Kit

4-SEC896Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermcidin elisa. Alternative names of the recognized antigen: HCAP
  • AIDD
  • DCD1
  • DSEP
  • PIF
  • Proteolysis Inducing Factor
  • Preproteolysin
  • Diffusible Survival/Evasion Peptide
  • Survival Promoting Peptide
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Dermcidin (DCD) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Dermcidin ELISA Kit (DCD)

RK03614 96 Tests
EUR 521

ELISA kit for Human DCD (Dermcidin)

ELK2908 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dermcidin (DCD) Antibody

20-abx109721
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx141389
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx100245
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dermcidin (DCD) Antibody

abx032955-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

abx032955-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx005487
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody

20-abx172090
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

20-abx172091
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

20-abx176148
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermcidin (DCD) Antibody

abx232263-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Recombinant Dermcidin (DCD)

4-RPC896Hu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P81605
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Dermcidin expressed in: E.coli

Human Dermcidin (DCD) CLIA Kit

20-abx493964
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dermcidin (DCD) Protein

20-abx066308
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

ELISA kit for Rat DCD (Dermcidin)

ELK6013 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermcidin (DCD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermcidin (DCD). N
  • Show more
Description: A sandwich ELISA kit for detection of Dermcidin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Dermcidin (DCD) CLIA Kit

20-abx493965
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Dermcidin (DCD) Protein

20-abx653162
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Antibody (HRP)

20-abx108177
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)

20-abx105339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (FITC)

20-abx106758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermcidin (DCD) Antibody (Biotin)

20-abx272301
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dermcidin (DCD) Polyclonal Antibody (Human)

4-PAC896Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD)

Dermcidin (DCD) Polyclonal Antibody (Human), APC

4-PAC896Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC.

Dermcidin (DCD) Polyclonal Antibody (Human), Biotinylated

4-PAC896Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Biotin.

Dermcidin (DCD) Polyclonal Antibody (Human), Cy3

4-PAC896Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with Cy3.

Dermcidin (DCD) Polyclonal Antibody (Human), FITC

4-PAC896Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with FITC.

Dermcidin (DCD) Polyclonal Antibody (Human), HRP

4-PAC896Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with HRP.

Dermcidin (DCD) Polyclonal Antibody (Human), PE

4-PAC896Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with PE.

Human PIF/DCD(Proteolysis Inducing Factor/Dermcidin) ELISA Kit

EH4251 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P81605
  • Alias: AIDD, DCD-1, DSEP, HCAP, MGC71930, PIF, diffusible survival/evasion peptide|preproteolysin|proteolysis inducing factor|survival promoting peptide
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit

CSB-E13626h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD)ELISA Kit

1-CSB-E13626h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proteolysis Inducing Factor/Dermcidin(PIF/DCD) in samples from serum, plasma, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Dermcidin (DCD) Polyclonal Antibody (Human), APC-Cy7

4-PAC896Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCD (Cys18~Leu110)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermcidin (DCD). This antibody is labeled with APC-Cy7.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-48T 48T
EUR 354
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD)

KTE62411-96T 96T
EUR 572
  • Dermcidin is a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Proteolysis Inducing Factor/Dermcidin (PIF/DCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-100ug

QP5914-ec-100ug 100ug
EUR 408

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-10ug

QP5914-ec-10ug 10ug
EUR 200

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-1mg

QP5914-ec-1mg 1mg
EUR 1632

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-200ug

QP5914-ec-200ug 200ug
EUR 634

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-500ug

QP5914-ec-500ug 500ug
EUR 1060

Recombinant Human Dermcidin/ DCD Protein, GST, E.coli-50ug

QP5914-ec-50ug 50ug
EUR 263

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-100ug

QP5914-ye-100ug 100ug
EUR 480

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-10ug

QP5914-ye-10ug 10ug
EUR 236

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-1mg

QP5914-ye-1mg 1mg
EUR 1885

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-200ug

QP5914-ye-200ug 200ug
EUR 744

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-500ug

QP5914-ye-500ug 500ug
EUR 1206

Recombinant Human Dermcidin/ DCD Protein, His, Yeast-50ug

QP5914-ye-50ug 50ug
EUR 299

Dermcidin

D077-5MG 5mg
EUR 349

PIF/DCD ELISA KIT|Human

EF007421 96 Tests
EUR 689

Dermcidin-1L (human)

H-7316.0500 0.5mg
EUR 177
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

Dermcidin-1L (human)

H-7316.1000 1.0mg
EUR 294
Description: Sum Formula: C210H359N57O71; CAS# [478898-18-9] net

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DCD siRNA

20-abx913661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCD Antibody

47246-100ul 100ul
EUR 252

DCD Antibody

1-CSB-PA006537DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human DCD shRNA Plasmid

20-abx964554
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCD Recombinant Protein (Human)

RP008806 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DCD Conjugated Antibody

C47246 100ul
EUR 397

DCD cloning plasmid

CSB-CL006537HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgaggttcatgactctcctcttcctgacagctctggcaggagccctggtctgtgcctatgatccagaggccgcctctgccccaggatcggggaacccttgccatgaagcatcagcagctcaaaaggaaaatgcaggtgaagacccagggttagccagacaggcaccaaagccaag
  • Show more
Description: A cloning plasmid for the DCD gene.

anti- DCD antibody

FNab02263 100µg
EUR 585
  • Immunogen: dermcidin
  • Uniprot ID: P81605
  • Gene ID: 117159
  • Research Area: Immunology
Description: Antibody raised against DCD

DCD Polyclonal Antibody

A53288 100 µg
EUR 570.55
Description: Ask the seller for details

DCD Rabbit pAb

A7280-100ul 100 ul
EUR 308

DCD Rabbit pAb

A7280-200ul 200 ul
EUR 459

DCD Rabbit pAb

A7280-20ul 20 ul
EUR 183

DCD Rabbit pAb

A7280-50ul 50 ul
EUR 223

Anti-DCD antibody

PAab02263 100 ug
EUR 412

Anti-DCD antibody

STJ29419 100 µl
EUR 277
Description: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DCD ORF Vector (Human) (pORF)

ORF002936 1.0 ug DNA
EUR 95

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

DCD Antibody, HRP conjugated

1-CSB-PA006537DB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DCD Antibody, FITC conjugated

1-CSB-PA006537DC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DCD Antibody, Biotin conjugated

1-CSB-PA006537DD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCD. Recognizes DCD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

DCD sgRNA CRISPR Lentivector set (Human)

K0564501 3 x 1.0 ug
EUR 339

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DCD sgRNA CRISPR Lentivector (Human) (Target 1)

K0564502 1.0 ug DNA
EUR 154

DCD sgRNA CRISPR Lentivector (Human) (Target 2)

K0564503 1.0 ug DNA
EUR 154

DCD sgRNA CRISPR Lentivector (Human) (Target 3)

K0564504 1.0 ug DNA
EUR 154

DCD Protein Vector (Human) (pPB-C-His)

PV011741 500 ng
EUR 329

DCD Protein Vector (Human) (pPB-N-His)

PV011742 500 ng
EUR 329

DCD Protein Vector (Human) (pPM-C-HA)

PV011743 500 ng
EUR 329

DCD Protein Vector (Human) (pPM-C-His)

PV011744 500 ng
EUR 329

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Polyclonal DCD Antibody (C-term)

APR10835G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCD (C-term). This antibody is tested and proven to work in the following applications:

DCD Polyclonal Antibody, Biotin Conjugated

A53285 100 µg
EUR 570.55
Description: reagents widely cited

DCD Polyclonal Antibody, FITC Conjugated

A53286 100 µg
EUR 570.55
Description: Ask the seller for details

DCD Polyclonal Antibody, HRP Conjugated

A53287 100 µg
EUR 570.55
Description: The best epigenetics products

Recombinant Aeromonas Hydrophila dcd Protein

VAng-Lsx0888-1mgEcoli 1 mg (E. coli)
EUR 3630
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Aeromonas Hydrophila dcd Protein

VAng-Lsx0888-500gEcoli 500 µg (E. coli)
EUR 2460
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Aeromonas Hydrophila dcd Protein

VAng-Lsx0888-50gEcoli 50 µg (E. coli)
EUR 1676
Description: Aeromonas Hydrophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Aeromonas Salmonicida dcd Protein

VAng-Lsx1258-1mgEcoli 1 mg (E. coli)
EUR 3630
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Aeromonas Salmonicida dcd Protein

VAng-Lsx1258-500gEcoli 500 µg (E. coli)
EUR 2460
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Aeromonas Salmonicida dcd Protein

VAng-Lsx1258-50gEcoli 50 µg (E. coli)
EUR 1676
Description: Aeromonas Salmonicida Deoxycytidine triphosphate deaminase, recombinant protein.

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

DCD 3'UTR Luciferase Stable Cell Line

TU005610 1.0 ml
EUR 1394

DCD 3'UTR GFP Stable Cell Line

TU055610 1.0 ml
EUR 1394

DCD sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0564505 3 x 1.0 ug
EUR 376

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Recombinant Pasteurella Multocida dcd Protein (aa 1-194)

VAng-Cr6769-1mgEcoli 1 mg (E. coli)
EUR 3432
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Pasteurella Multocida dcd Protein (aa 1-194)

VAng-Cr6769-500gEcoli 500 µg (E. coli)
EUR 2456
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Pasteurella Multocida dcd Protein (aa 1-194)

VAng-Cr6769-50gEcoli 50 µg (E. coli)
EUR 1673
Description: Pasteurella Multocida (strain Pm70) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Clostridium Thermocellum dcd Protein (aa 1-178)

VAng-Lsx01921-1mgEcoli 1 mg (E. coli)
EUR 3338
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Clostridium Thermocellum dcd Protein (aa 1-178)

VAng-Lsx01921-500gEcoli 500 µg (E. coli)
EUR 2548
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Clostridium Thermocellum dcd Protein (aa 1-178)

VAng-Lsx01921-50gEcoli 50 µg (E. coli)
EUR 1630
Description: Clostridium Thermocellum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Mycobacterium Paratuberculosis dcd Protein (aa 1-190)

VAng-Yyj0846-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Mycobacterium Paratuberculosis Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Avium dcd Protein(aa 1-190)

VAng-Yyj1176-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193)

VAng-Cr1804-1mgEcoli 1 mg (E. coli)
EUR 3420
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193)

VAng-Cr1804-500gEcoli 500 µg (E. coli)
EUR 2449
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Yersinia Enterocolitica dcd Protein (aa 1-193)

VAng-Cr1804-50gEcoli 50 µg (E. coli)
EUR 1676
Description: Yersinia Enterocolitica serotype O:8 / biotype 1B (strain 8081) deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Leprae dcd Protein (aa 1-190)

VAng-Yyj1902-1mgEcoli 1 mg (E. coli)
EUR 3396
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Leprae dcd Protein (aa 1-190)

VAng-Yyj1902-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Leprae dcd Protein (aa 1-190)

VAng-Yyj1902-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Mycobacterium Leprae Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Avium dcd Protein (aa 1-190)

VAng-Yyj2512-1mgEcoli 1 mg (E. coli)
EUR 3420
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Avium dcd Protein (aa 1-190)

VAng-Yyj2512-500gEcoli 500 µg (E. coli)
EUR 2437
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Mycobacterium Avium dcd Protein (aa 1-190)

VAng-Yyj2512-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Mycobacterium Avium (strain 104) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193)

VAng-Cr4744-1mgEcoli 1 mg (E. coli)
EUR 3432
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193)

VAng-Cr4744-500gEcoli 500 µg (E. coli)
EUR 2456
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Klebsiella Pneumoniae dcd Protein (aa 1-193)

VAng-Cr4744-50gEcoli 50 µg (E. coli)
EUR 1673
Description: Klebsiella Pneumoniae (strain 342) Deoxycytidine triphosphate deaminase (dcd), recombinant protein.

Recombinant Shigella Sonnei dcd Protein (aa 1-193)

VAng-Lsx09626-1mgEcoli 1 mg (E. coli)
EUR 3652
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Shigella Sonnei dcd Protein (aa 1-193)

VAng-Lsx09626-500gEcoli 500 µg (E. coli)
EUR 2456
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Shigella Sonnei dcd Protein (aa 1-193)

VAng-Lsx09626-50gEcoli 50 µg (E. coli)
EUR 1673
Description: Shigella Sonnei (strain Ss046) Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Concisus dcd Protein (aa 1-186)

VAng-Lsx5791-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Concisus dcd Protein (aa 1-186)

VAng-Lsx5791-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Concisus dcd Protein (aa 1-186)

VAng-Lsx5791-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Campylobacter Concisus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Curvus dcd Protein (aa 1-186)

VAng-Lsx5944-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Curvus dcd Protein (aa 1-186)

VAng-Lsx5944-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Curvus dcd Protein (aa 1-186)

VAng-Lsx5944-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Campylobacter Curvus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Fetus dcd Protein (aa 1-186)

VAng-Lsx6078-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Fetus dcd Protein (aa 1-186)

VAng-Lsx6078-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Fetus dcd Protein (aa 1-186)

VAng-Lsx6078-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Campylobacter Fetus subsp. fetus Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Jejuni dcd Protein (aa 1-186)

VAng-Lsx6229-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Jejuni dcd Protein (aa 1-186)

VAng-Lsx6229-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Campylobacter Jejuni dcd Protein (aa 1-186)

VAng-Lsx6229-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Campylobacter Jejuni Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Bordetella Avium dcd Protein (aa 1-187)

VAng-Lsx4252-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Bordetella Avium dcd Protein (aa 1-187)

VAng-Lsx4252-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Bordetella Avium dcd Protein (aa 1-187)

VAng-Lsx4252-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Bordetella Avium Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Helicobacter Pylori dcd Protein (aa 1-188)

VAng-Lsx3399-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein.

Recombinant Helicobacter Pylori dcd Protein (aa 1-188)

VAng-Lsx3399-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein.

Recombinant Helicobacter Pylori dcd Protein (aa 1-188)

VAng-Lsx3399-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Helicobacter Pylori Deoxycytidine triphosphate deaminas, recombinant protein.

Recombinant Legionella Pneumophila dcd Protein (aa 1-188)

VAng-Lsx3850-1mgEcoli 1 mg (E. coli)
EUR 3572
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Legionella Pneumophila dcd Protein (aa 1-188)

VAng-Lsx3850-500gEcoli 500 µg (E. coli)
EUR 2425
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Legionella Pneumophila dcd Protein (aa 1-188)

VAng-Lsx3850-50gEcoli 50 µg (E. coli)
EUR 1653
Description: Legionella Pneumophila Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173)

VAng-Lsx7545-1mgEcoli 1 mg (E. coli)
EUR 3525
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173)

VAng-Lsx7545-500gEcoli 500 µg (E. coli)
EUR 2548
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Clostridium Acetobutylicum dcd Protein (aa 1-173)

VAng-Lsx7545-50gEcoli 50 µg (E. coli)
EUR 1630
Description: Clostridium Acetobutylicum Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Shigella Dysenteriae dcd Protein (aa 1-193)

VAng-Lsx06819-1mgEcoli 1 mg (E. coli)
EUR 3432
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Deoxycytidine triphosphate deaminase, recombinant protein.

Recombinant Shigella Dysenteriae dcd Protein (aa 1-193)

VAng-Lsx06819-500gEcoli 500 µg (E. coli)
EUR 2456
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Deoxycytidine triphosphate deaminase, recombinant protein.