Human LACRT(Lacritin) ELISA Kit

Human LACRT(Lacritin) ELISA Kit

To Order Contact us:  Yamada@jsce-ip.com

Human Lacritin (LACRT) ELISA Kit

RD-LACRT-Hu-96Tests 96 Tests
EUR 723

Human Lacritin (LACRT) ELISA Kit

20-abx152147
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lacritin(LACRT)ELISA Kit

QY-E04824 96T
EUR 361

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

SEC576Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids.

Human Lacritin (LACRT) ELISA Kit

4-SEC576Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lacritin elisa. Alternative names of the recognized antigen: Extracellular glycoprotein lacritin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lacritin (LACRT) in samples from saliva, tears and other biological fluids with no significant corss-reactivity with analogues from other species.

Lacritin (LACRT) Antibody

20-abx113422
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lacritin (LACRT) Antibody

20-abx128613
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lacritin (LACRT) Antibody

20-abx173283
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Lacritin (LACRT)

4-RPC576Hu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZZ8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Lacritin expressed in: E.coli

Human Lacritin (LACRT) Protein

20-abx167137
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Lacritin (LACRT) CLIA Kit

20-abx493773
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human LACRT (Lacritin)

ELK2907 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lacritin (LACRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lacritin (LACRT).
  • Show more
Description: A sandwich ELISA kit for detection of Lacritin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human LACRT (Extracellular glycoprotein lacritin) ELISA Kit

ELI-42678h 96 Tests
EUR 824

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-48T 48T
EUR 332
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Extracellular glycoprotein lacritin (LACRT)

KTE61868-96T 96T
EUR 539
  • Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells. Lacritin is thus a prosecretory mitog
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Extracellular Glycoprotein Lacritin (LACRT) Antibody

abx234671-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse)

4-PAC576Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT)

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC

4-PAC576Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC576Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Biotin.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC576Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Cy3.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), FITC

4-PAC576Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with FITC.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), HRP

4-PAC576Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with HRP.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), PE

4-PAC576Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with PE.

Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC576Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LACRT (Glu20~Ala138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC-Cy7.

LACRT ELISA KIT|Human

EF010606 96 Tests
EUR 689

LACRT ELISA Kit (Human) (OKCD00685)

OKCD00685 96 Wells
EUR 831
Description: Description of target: Modulates secretion by lacrimal acinar cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

LACRT ELISA Kit (Human) (OKDD00367)

OKDD00367 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

LACRT antibody

70R-18201 50 ul
EUR 435
Description: Rabbit polyclonal LACRT antibody

LACRT Antibody

1-CSB-PA012715GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LACRT. Recognizes LACRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

LACRT siRNA

20-abx922200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human LACRT shRNA Plasmid

20-abx963898
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LACRT Recombinant Protein (Human)

RP017461 100 ug Ask for price

LACRT Recombinant Protein (Human)

RP017464 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

LACRT Polyclonal Antibody

28656-100ul 100ul
EUR 252

LACRT Polyclonal Antibody

28656-50ul 50ul
EUR 187

LACRT Rabbit pAb

A14632-100ul 100 ul
EUR 308

LACRT Rabbit pAb

A14632-200ul 200 ul
EUR 459

LACRT Rabbit pAb

A14632-20ul 20 ul
EUR 183

LACRT Rabbit pAb

A14632-50ul 50 ul
EUR 223

LACRT cloning plasmid

CSB-CL887939HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
  • Show more
Description: A cloning plasmid for the LACRT gene.

LACRT cloning plasmid

CSB-CL887939HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 417
  • Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
  • Show more
Description: A cloning plasmid for the LACRT gene.

anti- LACRT antibody

FNab04671 100µg
EUR 585
  • Immunogen: lacritin
  • Uniprot ID: Q9GZZ8
  • Gene ID: 90070
  • Research Area: Epigenetics, Signal Transduction
Description: Antibody raised against LACRT

Anti-LACRT antibody

PAab04671 100 ug
EUR 412

Anti-LACRT antibody

STJ116839 100 µl
EUR 277
Description: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.

LACRT ORF Vector (Human) (pORF)

ORF005821 1.0 ug DNA
EUR 95

LACRT ORF Vector (Human) (pORF)

ORF005822 1.0 ug DNA
EUR 95

LACRT Polyclonal Conjugated Antibody

C28656 100ul
EUR 397

LACRT sgRNA CRISPR Lentivector set (Human)

K1192801 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

LACRT sgRNA CRISPR Lentivector (Human) (Target 1)

K1192802 1.0 ug DNA
EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 2)

K1192803 1.0 ug DNA
EUR 154

LACRT sgRNA CRISPR Lentivector (Human) (Target 3)

K1192804 1.0 ug DNA
EUR 154

LACRT Protein Vector (Human) (pPB-C-His)

PV023281 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-N-His)

PV023282 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)

PV023283 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-His)

PV023284 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-C-His)

PV023285 500 ng
EUR 329

LACRT Protein Vector (Human) (pPB-N-His)

PV023286 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-HA)

PV023287 500 ng
EUR 329

LACRT Protein Vector (Human) (pPM-C-His)

PV023288 500 ng
EUR 329

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711849 1.0 ug DNA
EUR 316

LACRT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711853 1.0 ug DNA
EUR 316

LACRT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711854 1.0 ug DNA
EUR 316

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

LACRT 3'UTR GFP Stable Cell Line

TU062232 1.0 ml
EUR 1394

LACRT 3'UTR Luciferase Stable Cell Line

TU012232 1.0 ml
EUR 1394

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1192805 3 x 1.0 ug
EUR 376

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV711850 1.0 ug DNA
EUR 316

LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV711851 1.0 ug DNA
EUR 374

LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV711852 1.0 ug DNA
EUR 374

LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1192806 1.0 ug DNA
EUR 167

LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1192807 1.0 ug DNA
EUR 167

LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1192808 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)

OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)

OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit

201-12-0005 96 tests
EUR 440
  • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit

201-12-0017 96 tests
EUR 440
  • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit

201-12-0026 96 tests
EUR 440
  • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit

201-12-0027 96 tests
EUR 440
  • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit

201-12-0156 96 tests
EUR 440
  • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT

201-12-0339 96 tests
EUR 440
  • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit

201-12-0354 96 tests
EUR 440
  • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit

201-12-0414 96 tests
EUR 440
  • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit

201-12-0416 96 tests
EUR 440
  • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit

201-12-0620 96 tests
EUR 440
  • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ponticulin ELISA Kit

201-12-0633 96 tests
EUR 440
  • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit2 ELISA Kit

201-12-0662 96 tests
EUR 440
  • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human trypsin ELISA Kit

201-12-0805 96 tests
EUR 440
  • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Elastase ELISA Kit

201-12-0812 96 tests
EUR 440
  • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-glucosidase ELISA Kit

201-12-0854 96 tests
EUR 440
  • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-lactamase ELISA Kit

201-12-0856 96 tests
EUR 440
  • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Methylase ELISA Kit

201-12-0927 96 tests
EUR 440
  • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Pancreastatin ELISA Kit

201-12-0984 96 tests
EUR 440
  • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cortisol ELISA Kit

201-12-1004 96 tests
EUR 440
  • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Renin ELISA Kit

201-12-1017 96 tests
EUR 440
  • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human podocin ELISA Kit

201-12-1083 96 tests
EUR 440
  • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Nephrin ELISA Kit

201-12-1092 96 tests
EUR 440
  • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human gelson ELISA Kit

201-12-1204 96 tests
EUR 440
  • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin ? ELISA Kit

201-12-1269 96 tests
EUR 440
  • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Salusin-? ELISA Kit

201-12-1273 96 tests
EUR 440
  • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human chemerin ELISA Kit

201-12-1436 96 tests
EUR 440
  • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human dystrophin ELISA Kit

201-12-1446 96 tests
EUR 440
  • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human preptin ELISA Kit

201-12-1449 96 tests
EUR 440
  • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human p16 ELISA Kit

201-12-1638 96 tests
EUR 440
  • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human colicin ELISA Kit

201-12-1747 96 tests
EUR 440
  • This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amebiasis ELISA Kit

201-12-1748 96 tests
EUR 440
  • This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human schistosoma ELISA Kit

201-12-1749 96 tests
EUR 440
  • This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Enterovirus ELISA Kit

201-12-1809 96 tests
EUR 440
  • This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human flagellin ELISA Kit

201-12-1815 96 tests
EUR 440
  • This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cotinine ELISA Kit

201-12-2044 96 tests
EUR 440
  • This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Myostatin ELISA Kit

201-12-2092 96 tests
EUR 440
  • This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Haponin ELISA Kit

201-12-2740 96 tests
EUR 440
  • This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ANG ELISA Kit

55R-1555 1 kit
EUR 651
Description: ELISA kit for detection of ANG in the research laboratory

Human BDNF ELISA Kit

55R-1556 1 kit
EUR 428
Description: ELISA kit for detection of BDNF in the research laboratory

Human BMP5 ELISA Kit

55R-1559 1 kit
EUR 624
Description: ELISA kit for detection of BMP-5 in the research laboratory

Human BMP2 ELISA Kit

55R-1560 1 kit
EUR 624
Description: ELISA kit for detection of BMP2 in the research laboratory

Human BMP4 ELISA Kit

55R-1563 1 kit
EUR 651
Description: ELISA Kit for detection of BMP4 in the research laboratory

Human EGF ELISA Kit

55R-1564 1 kit
EUR 503
Description: ELISA kit for detection of EGF in the research laboratory

Human EGFR ELISA Kit

55R-1566 1 kit
EUR 503
Description: ELISA kit for detection of EGFR in the research laboratory

Human Eotaxin ELISA Kit

55R-1567 1 kit
EUR 530
Description: ELISA kit for detection of Eotaxin in the research laboratory

Human FAS ELISA Kit

55R-1570 1 kit
EUR 469
Description: ELISA kit for detection of FAS in the research laboratory

Human FASL ELISA Kit

55R-1572 1 kit
EUR 651
Description: ELISA Kit for detection of FASL in the research laboratory

Human FGF9 ELISA Kit

55R-1573 1 kit
EUR 671
Description: ELISA kit for detection of FGF9 in the research laboratory

Human Fibronectin ELISA kit

55R-1574 1 kit
EUR 368
Description: ELISA kit for the detection of Fibronectin in the research laboratory

Human CX3CL1 ELISA Kit

55R-1577 1 kit
EUR 617
Description: ELISA Kit for detection of CX3CL1 in the research laboratory

Human CX3CL1 ELISA Kit

55R-1578 1 kit
EUR 624
Description: ELISA Kit for detection of CX3CL1 in the research laboratory

Human GCSF ELISA kit

55R-1579 1 kit
EUR 415
Description: ELISA kit for the detection of Human GCSF in the research laboratory

Human GDNF ELISA Kit

55R-1581 1 kit
EUR 590
Description: ELISA kit for detection of GDNF in the research laboratory

Human GMCSF ELISA kit

55R-1583 1 kit
EUR 624
Description: ELISA kit for the detection of GMCSF in the research laboratory

Human HGF ELISA kit

55R-1586 1 kit
EUR 503
Description: ELISA kit for the detection of Human HGF in the research laboratory

Human ICAM1 ELISA Kit

55R-1587 1 kit
EUR 503
Description: ELISA kit for detection of ICAM1 in the research laboratory

Human IGFBP1 ELISA Kit

55R-1598 1 kit
EUR 550
Description: ELISA kit for detection of IGFBP1 in the research laboratory

Human IGFBP3 ELISA kit

55R-1600 1 kit
EUR 550
Description: ELISA kit for the detection of IGFBP3 in the research laboratory

Human IL2 ELISA kit

55R-1608 1 kit
EUR 496
Description: ELISA kit for the detection of IL2 in the research laboratory

Human IL3 ELISA Kit

55R-1611 1 kit
EUR 503
Description: ELISA kit for detection of IL3 in the research laboratory

Human IL4 ELISA Kit

55R-1613 1 kit
EUR 415
Description: ELISA kit for detection of Human IL4 in the research laboratory

Human IL5 ELISA kit

55R-1616 1 kit
EUR 530
Description: ELISA kit for the detection of IL5 in the research laboratory

Human IL6 ELISA Kit

55R-1618 1 kit
EUR 415
Description: ELISA kit for detection of Human IL6 in the research laboratory

Human IL8 ELISA Kit

55R-1621 1 kit
EUR 401
Description: ELISA kit for detection of Human IL8 in the research laboratory

Human IL10 ELISA Kit

55R-1622 1 kit
EUR 401
Description: ELISA kit for detection of Human IL10 in the research laboratory

Human IL15 ELISA Kit

55R-1629 1 kit
EUR 476
Description: ELISA kit for detection of IL15 in the research laboratory

Human IL17 ELISA Kit

55R-1630 1 kit
EUR 503
Description: ELISA kit for detection of IL17 in the research laboratory

Human Laminin ELISA Kit

55R-1632 1 kit
EUR 651
Description: ELISA kit for detection of Laminin in the research laboratory

Human Leptin ELISA kit

55R-1635 1 kit
EUR 476
Description: ELISA kit for the detection of Human Leptin in the research laboratory

Human MCP1 ELISA kit

55R-1639 1 kit
EUR 476
Description: ELISA kit for the detection of MCP1 in the research laboratory

Human MCSF ELISA Kit

55R-1640 1 kit
EUR 503
Description: ELISA Kit for detection of MCSF in the research laboratory

Human MDC ELISA Kit

55R-1642 1 kit
EUR 550
Description: ELISA kit for detection of MDC in the research laboratory

Human MMP1 ELISA Kit

55R-1648 1 kit
EUR 590
Description: ELISA kit for detection of MMP1 in the research laboratory

Human MMP2 ELISA Kit

55R-1649 1 kit
EUR 590
Description: ELISA kit for detection of MMP2 in the research laboratory

Human MMP3 ELISA Kit

55R-1651 1 kit
EUR 590
Description: ELISA Kit for detection of MMP3 in the research laboratory

Human MMP8 ELISA Kit

55R-1654 1 kit
EUR 671
Description: ELISA kit for detection of MMP8 in the research laboratory

Human MMP9 ELISA kit

55R-1655 1 kit
EUR 671
Description: ELISA kit for the detection of MMP9 in the research laboratory

Human MMP13 ELISA kit

55R-1657 1 kit
EUR 624
Description: ELISA kit for the detection of MMP13 in the research laboratory

Human NGFb ELISA Kit

55R-1658 1 kit
EUR 550
Description: ELISA Kit for detection of NGFb in the research laboratory

Human OPG ELISA kit

55R-1664 1 kit
EUR 503
Description: ELISA kit for the detection of OPG in the research laboratory

Human OPN ELISA Kit

55R-1666 1 kit
EUR 550
Description: ELISA kit for detection of OPN in the research laboratory

Human PDGFAB ELISA Kit

55R-1668 1 kit
EUR 476
Description: ELISA Kit for detection of PDGFAB in the research laboratory

Human Rantes ELISA Kit

55R-1672 1 kit
EUR 550
Description: ELISA kit for detection of Rantes in the research laboratory

Human TGFB1 ELISA Kit

55R-1682 1 kit
EUR 476
Description: ELISA Kit for detection of TGFB1 in the research laboratory

Human TIE2 ELISA Kit

55R-1686 1 kit
EUR 604
Description: ELISA kit for detection of TIE2 in the research laboratory