Human LACRT(Lacritin) ELISA Kit
To Order Contact us: Yamada@jsce-ip.com
 ELISA Kit) Human Lacritin (LACRT) ELISA Kit |
|
RD-LACRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Lacritin (LACRT) ELISA Kit |
|
20-abx152147 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lacritin (LACRT) ELISA Kit |
|
SEC576Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
|
SEC576Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
|
SEC576Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
|
SEC576Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
|
4-SEC576Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lacritin elisa. Alternative names of the recognized antigen: Extracellular glycoprotein lacritin
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lacritin (LACRT) in samples from saliva, tears and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Lacritin (LACRT) Antibody |
|
20-abx113422 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lacritin (LACRT) Antibody |
|
20-abx128613 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Lacritin (LACRT) Antibody |
|
20-abx173283 |
Abbexa |
|
|
|
|
) Recombinant Lacritin (LACRT) |
|
4-RPC576Hu01 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9GZZ8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 44.7kDa
- Isoelectric Point: 6.1
|
|
Description: Recombinant Human Lacritin expressed in: E.coli |
 Protein) Human Lacritin (LACRT) Protein |
|
20-abx167137 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human Lacritin (LACRT) CLIA Kit |
|
20-abx493773 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Human LACRT (Lacritin) |
|
ELK2907 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lacritin (LACRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lacritin (LACRT).
- Show more
|
|
Description: A sandwich ELISA kit for detection of Lacritin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 ELISA Kit) Human LACRT (Extracellular glycoprotein lacritin) ELISA Kit |
|
ELI-42678h |
Lifescience Market |
96 Tests |
EUR 824 |
) ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
|
KTE61868-48T |
Abbkine |
48T |
EUR 332 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
|
KTE61868-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
|
KTE61868-96T |
Abbkine |
96T |
EUR 539 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Antibody) Extracellular Glycoprotein Lacritin (LACRT) Antibody |
|
abx234671-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human, Mouse)) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse) |
|
4-PAC576Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT) |
 Polyclonal Antibody (Human, Mouse), APC) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC |
|
4-PAC576Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Mouse), Biotinylated) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Biotinylated |
|
4-PAC576Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Mouse), Cy3) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Cy3 |
|
4-PAC576Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Mouse), FITC) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), FITC |
|
4-PAC576Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Mouse), HRP) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), HRP |
|
4-PAC576Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Mouse), PE) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), PE |
|
4-PAC576Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with PE. |
 Polyclonal Antibody (Human, Mouse), APC-Cy7) Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
|
4-PAC576Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC-Cy7. |
 (OKCD00685)) LACRT ELISA Kit (Human) (OKCD00685) |
|
OKCD00685 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Modulates secretion by lacrimal acinar cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL |
 (OKDD00367)) LACRT ELISA Kit (Human) (OKDD00367) |
|
OKDD00367 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
 LACRT antibody |
|
70R-18201 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal LACRT antibody |
 LACRT Antibody |
|
1-CSB-PA012715GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against LACRT. Recognizes LACRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
 LACRT siRNA |
|
20-abx922200 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human LACRT shRNA Plasmid |
|
20-abx963898 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) LACRT Recombinant Protein (Human) |
|
RP017461 |
ABM |
100 ug |
Ask for price |
LACRT Recombinant Protein (Human) |
|
RP017464 |
ABM |
100 ug |
Ask for price |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 LACRT Polyclonal Antibody |
|
28656-100ul |
SAB |
100ul |
EUR 252 |
LACRT Polyclonal Antibody |
|
28656-50ul |
SAB |
50ul |
EUR 187 |
 LACRT Rabbit pAb |
|
A14632-100ul |
Abclonal |
100 ul |
EUR 308 |
LACRT Rabbit pAb |
|
A14632-200ul |
Abclonal |
200 ul |
EUR 459 |
LACRT Rabbit pAb |
|
A14632-20ul |
Abclonal |
20 ul |
EUR 183 |
LACRT Rabbit pAb |
|
A14632-50ul |
Abclonal |
50 ul |
EUR 223 |
 LACRT cloning plasmid |
|
CSB-CL887939HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 417
- Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
- Show more
|
|
Description: A cloning plasmid for the LACRT gene. |
LACRT cloning plasmid |
|
CSB-CL887939HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 417
- Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
- Show more
|
|
Description: A cloning plasmid for the LACRT gene. |
 anti- LACRT antibody |
|
FNab04671 |
FN Test |
100µg |
EUR 585 |
- Immunogen: lacritin
- Uniprot ID: Q9GZZ8
- Gene ID: 90070
- Research Area: Epigenetics, Signal Transduction
|
|
Description: Antibody raised against LACRT |
 Anti-LACRT antibody |
|
STJ116839 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium. |
 (pORF)) LACRT ORF Vector (Human) (pORF) |
|
ORF005821 |
ABM |
1.0 ug DNA |
EUR 95 |
LACRT ORF Vector (Human) (pORF) |
|
ORF005822 |
ABM |
1.0 ug DNA |
EUR 95 |
 LACRT Polyclonal Conjugated Antibody |
|
C28656 |
SAB |
100ul |
EUR 397 |
) LACRT sgRNA CRISPR Lentivector set (Human) |
|
K1192801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 (Target 1)) LACRT sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1192802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) LACRT sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1192803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) LACRT sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1192804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) LACRT Protein Vector (Human) (pPB-C-His) |
|
PV023281 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) LACRT Protein Vector (Human) (pPB-N-His) |
|
PV023282 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) LACRT Protein Vector (Human) (pPM-C-HA) |
|
PV023283 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) LACRT Protein Vector (Human) (pPM-C-His) |
|
PV023284 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPB-C-His) |
|
PV023285 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPB-N-His) |
|
PV023286 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-HA) |
|
PV023287 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-His) |
|
PV023288 |
ABM |
500 ng |
EUR 329 |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
 (CMV) (pLenti-GIII-CMV)) LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV711849 |
ABM |
1.0 ug DNA |
EUR 316 |
 (UbC) (pLenti-GIII-UbC)) LACRT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV711853 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) LACRT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV711854 |
ABM |
1.0 ug DNA |
EUR 316 |
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
, Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)) AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
|
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
|
 LACRT 3'UTR GFP Stable Cell Line |
|
TU062232 |
ABM |
1.0 ml |
EUR 1394 |
 LACRT 3'UTR Luciferase Stable Cell Line |
|
TU012232 |
ABM |
1.0 ml |
EUR 1394 |
 vWF Acty. Kit |
|
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
 vWF Ant. Kit |
|
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
) hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
|
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
|
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
) PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
) PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
|
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
 PrecisionX Multiplex gRNA Cloning Kit |
|
CAS9-GRNA-KIT |
SBI |
10 rxn |
EUR 445 |
|
|
) LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K1192805 |
ABM |
3 x 1.0 ug |
EUR 376 |
 with goat anti-rabbit HRP secondary antibody) ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
|
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
|
) mRNAExpress mRNA Synthesis kit (5 reactions) |
|
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
 (CMV) (pLenti-GIII-CMV-C-term-HA)) LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
|
LV711850 |
ABM |
1.0 ug DNA |
EUR 316 |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
|
LV711851 |
ABM |
1.0 ug DNA |
EUR 374 |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
|
LV711852 |
ABM |
1.0 ug DNA |
EUR 374 |
 (Target 1)) LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K1192806 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
|
K1192807 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) LACRT sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
|
K1192808 |
ABM |
1.0 ug DNA |
EUR 167 |
) CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent) |
|
CASCL9-100A-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS |
|
AP-STR-KIT-P |
CORNING |
1/pk |
EUR 721 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
|
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
|
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
 Human KIT/SCFR ELISA kit |
|
LF-EK50791 |
Abfrontier |
1×96T |
EUR 648 |
 (OKAN04574)) KIT ELISA Kit (Human) (OKAN04574) |
|
OKAN04574 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
|
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL |
 (OKCD06003)) KIT ELISA Kit (Human) (OKCD06003) |
|
OKCD06003 |
Aviva Systems Biology |
96 Wells |
EUR 648 |
|
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL |
 Human Pentosidine ELISA Kit |
|
201-12-0005 |
SunredBio |
96 tests |
EUR 440 |
- This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Amylin ELISA Kit |
|
201-12-0017 |
SunredBio |
96 tests |
EUR 440 |
- This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human visfatin ELISA Kit |
|
201-12-0026 |
SunredBio |
96 tests |
EUR 440 |
- This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Secretin ELISA Kit |
|
201-12-0027 |
SunredBio |
96 tests |
EUR 440 |
- This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human omentin ELISA Kit |
|
201-12-0156 |
SunredBio |
96 tests |
EUR 440 |
- This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human Resistin ELISA KIT |
|
201-12-0339 |
SunredBio |
96 tests |
EUR 440 |
- This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Collectin ELISA Kit |
|
201-12-0354 |
SunredBio |
96 tests |
EUR 440 |
- This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Agrin ELISA Kit |
|
201-12-0414 |
SunredBio |
96 tests |
EUR 440 |
- This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Thymosin ELISA Kit |
|
201-12-0416 |
SunredBio |
96 tests |
EUR 440 |
- This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human talin ELISA Kit |
|
201-12-0620 |
SunredBio |
96 tests |
EUR 440 |
- This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ponticulin ELISA Kit |
|
201-12-0633 |
SunredBio |
96 tests |
EUR 440 |
- This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Slit2 ELISA Kit |
|
201-12-0662 |
SunredBio |
96 tests |
EUR 440 |
- This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human trypsin ELISA Kit |
|
201-12-0805 |
SunredBio |
96 tests |
EUR 440 |
- This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Elastase ELISA Kit |
|
201-12-0812 |
SunredBio |
96 tests |
EUR 440 |
- This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ?-glucosidase ELISA Kit |
|
201-12-0854 |
SunredBio |
96 tests |
EUR 440 |
- This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ?-lactamase ELISA Kit |
|
201-12-0856 |
SunredBio |
96 tests |
EUR 440 |
- This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Methylase ELISA Kit |
|
201-12-0927 |
SunredBio |
96 tests |
EUR 440 |
- This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Pancreastatin ELISA Kit |
|
201-12-0984 |
SunredBio |
96 tests |
EUR 440 |
- This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Cortisol ELISA Kit |
|
201-12-1004 |
SunredBio |
96 tests |
EUR 440 |
- This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Renin ELISA Kit |
|
201-12-1017 |
SunredBio |
96 tests |
EUR 440 |
- This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human podocin ELISA Kit |
|
201-12-1083 |
SunredBio |
96 tests |
EUR 440 |
- This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Nephrin ELISA Kit |
|
201-12-1092 |
SunredBio |
96 tests |
EUR 440 |
- This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human gelson ELISA Kit |
|
201-12-1204 |
SunredBio |
96 tests |
EUR 440 |
- This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Salusin ? ELISA Kit |
|
201-12-1269 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Salusin-? ELISA Kit |
|
201-12-1273 |
SunredBio |
96 tests |
EUR 440 |
- This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human chemerin ELISA Kit |
|
201-12-1436 |
SunredBio |
96 tests |
EUR 440 |
- This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human dystrophin ELISA Kit |
|
201-12-1446 |
SunredBio |
96 tests |
EUR 440 |
- This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human preptin ELISA Kit |
|
201-12-1449 |
SunredBio |
96 tests |
EUR 440 |
- This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human p16 ELISA Kit |
|
201-12-1638 |
SunredBio |
96 tests |
EUR 440 |
- This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human colicin ELISA Kit |
|
201-12-1747 |
SunredBio |
96 tests |
EUR 440 |
- This colicin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Amebiasis ELISA Kit |
|
201-12-1748 |
SunredBio |
96 tests |
EUR 440 |
- This Amebiasis ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 human schistosoma ELISA Kit |
|
201-12-1749 |
SunredBio |
96 tests |
EUR 440 |
- This schistosoma ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Enterovirus ELISA Kit |
|
201-12-1809 |
SunredBio |
96 tests |
EUR 440 |
- This Enterovirus ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human flagellin ELISA Kit |
|
201-12-1815 |
SunredBio |
96 tests |
EUR 440 |
- This flagellin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Cotinine ELISA Kit |
|
201-12-2044 |
SunredBio |
96 tests |
EUR 440 |
- This Cotinine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Myostatin ELISA Kit |
|
201-12-2092 |
SunredBio |
96 tests |
EUR 440 |
- This Myostatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human Haponin ELISA Kit |
|
201-12-2740 |
SunredBio |
96 tests |
EUR 440 |
- This Haponin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human ANG ELISA Kit |
|
55R-1555 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA kit for detection of ANG in the research laboratory |
 Human BDNF ELISA Kit |
|
55R-1556 |
Fitzgerald |
1 kit |
EUR 428 |
|
Description: ELISA kit for detection of BDNF in the research laboratory |
 Human BMP5 ELISA Kit |
|
55R-1559 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for detection of BMP-5 in the research laboratory |
 Human BMP2 ELISA Kit |
|
55R-1560 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for detection of BMP2 in the research laboratory |
 Human BMP4 ELISA Kit |
|
55R-1563 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA Kit for detection of BMP4 in the research laboratory |
 Human EGF ELISA Kit |
|
55R-1564 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of EGF in the research laboratory |
 Human EGFR ELISA Kit |
|
55R-1566 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of EGFR in the research laboratory |
 Human Eotaxin ELISA Kit |
|
55R-1567 |
Fitzgerald |
1 kit |
EUR 530 |
|
Description: ELISA kit for detection of Eotaxin in the research laboratory |
 Human FAS ELISA Kit |
|
55R-1570 |
Fitzgerald |
1 kit |
EUR 469 |
|
Description: ELISA kit for detection of FAS in the research laboratory |
 Human FASL ELISA Kit |
|
55R-1572 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA Kit for detection of FASL in the research laboratory |
 Human FGF9 ELISA Kit |
|
55R-1573 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for detection of FGF9 in the research laboratory |
 Human Fibronectin ELISA kit |
|
55R-1574 |
Fitzgerald |
1 kit |
EUR 368 |
|
Description: ELISA kit for the detection of Fibronectin in the research laboratory |
 Human CX3CL1 ELISA Kit |
|
55R-1577 |
Fitzgerald |
1 kit |
EUR 617 |
|
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
Human CX3CL1 ELISA Kit |
|
55R-1578 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA Kit for detection of CX3CL1 in the research laboratory |
 Human GCSF ELISA kit |
|
55R-1579 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for the detection of Human GCSF in the research laboratory |
 Human GDNF ELISA Kit |
|
55R-1581 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of GDNF in the research laboratory |
 Human GMCSF ELISA kit |
|
55R-1583 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for the detection of GMCSF in the research laboratory |
 Human HGF ELISA kit |
|
55R-1586 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for the detection of Human HGF in the research laboratory |
 Human ICAM1 ELISA Kit |
|
55R-1587 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of ICAM1 in the research laboratory |
 Human IGFBP1 ELISA Kit |
|
55R-1598 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of IGFBP1 in the research laboratory |
 Human IGFBP3 ELISA kit |
|
55R-1600 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for the detection of IGFBP3 in the research laboratory |
 Human IL2 ELISA kit |
|
55R-1608 |
Fitzgerald |
1 kit |
EUR 496 |
|
Description: ELISA kit for the detection of IL2 in the research laboratory |
 Human IL3 ELISA Kit |
|
55R-1611 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of IL3 in the research laboratory |
 Human IL4 ELISA Kit |
|
55R-1613 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for detection of Human IL4 in the research laboratory |
 Human IL5 ELISA kit |
|
55R-1616 |
Fitzgerald |
1 kit |
EUR 530 |
|
Description: ELISA kit for the detection of IL5 in the research laboratory |
 Human IL6 ELISA Kit |
|
55R-1618 |
Fitzgerald |
1 kit |
EUR 415 |
|
Description: ELISA kit for detection of Human IL6 in the research laboratory |
 Human IL8 ELISA Kit |
|
55R-1621 |
Fitzgerald |
1 kit |
EUR 401 |
|
Description: ELISA kit for detection of Human IL8 in the research laboratory |
 Human IL10 ELISA Kit |
|
55R-1622 |
Fitzgerald |
1 kit |
EUR 401 |
|
Description: ELISA kit for detection of Human IL10 in the research laboratory |
 Human IL15 ELISA Kit |
|
55R-1629 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for detection of IL15 in the research laboratory |
 Human IL17 ELISA Kit |
|
55R-1630 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for detection of IL17 in the research laboratory |
 Human Laminin ELISA Kit |
|
55R-1632 |
Fitzgerald |
1 kit |
EUR 651 |
|
Description: ELISA kit for detection of Laminin in the research laboratory |
 Human Leptin ELISA kit |
|
55R-1635 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for the detection of Human Leptin in the research laboratory |
 Human MCP1 ELISA kit |
|
55R-1639 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA kit for the detection of MCP1 in the research laboratory |
 Human MCSF ELISA Kit |
|
55R-1640 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA Kit for detection of MCSF in the research laboratory |
 Human MDC ELISA Kit |
|
55R-1642 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of MDC in the research laboratory |
 Human MMP1 ELISA Kit |
|
55R-1648 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of MMP1 in the research laboratory |
 Human MMP2 ELISA Kit |
|
55R-1649 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA kit for detection of MMP2 in the research laboratory |
 Human MMP3 ELISA Kit |
|
55R-1651 |
Fitzgerald |
1 kit |
EUR 590 |
|
Description: ELISA Kit for detection of MMP3 in the research laboratory |
 Human MMP8 ELISA Kit |
|
55R-1654 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for detection of MMP8 in the research laboratory |
 Human MMP9 ELISA kit |
|
55R-1655 |
Fitzgerald |
1 kit |
EUR 671 |
|
Description: ELISA kit for the detection of MMP9 in the research laboratory |
 Human MMP13 ELISA kit |
|
55R-1657 |
Fitzgerald |
1 kit |
EUR 624 |
|
Description: ELISA kit for the detection of MMP13 in the research laboratory |
 Human NGFb ELISA Kit |
|
55R-1658 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA Kit for detection of NGFb in the research laboratory |
 Human OPG ELISA kit |
|
55R-1664 |
Fitzgerald |
1 kit |
EUR 503 |
|
Description: ELISA kit for the detection of OPG in the research laboratory |
 Human OPN ELISA Kit |
|
55R-1666 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of OPN in the research laboratory |
 Human PDGFAB ELISA Kit |
|
55R-1668 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA Kit for detection of PDGFAB in the research laboratory |
 Human Rantes ELISA Kit |
|
55R-1672 |
Fitzgerald |
1 kit |
EUR 550 |
|
Description: ELISA kit for detection of Rantes in the research laboratory |
 Human TGFB1 ELISA Kit |
|
55R-1682 |
Fitzgerald |
1 kit |
EUR 476 |
|
Description: ELISA Kit for detection of TGFB1 in the research laboratory |
 Human TIE2 ELISA Kit |
|
55R-1686 |
Fitzgerald |
1 kit |
EUR 604 |
|
Description: ELISA kit for detection of TIE2 in the research laboratory |
ELISA Kit)
