Use and affect of the prehospital 12-lead ECG in the main PCI period (PHECG2): protocol for a mixed-method examine.
Use of the prehospital 12-lead ECG (PHECG) is really useful in sufferers presenting to emergency medical providers (EMS) with suspected acute coronary syndrome (ACS).
Prior analysis discovered that though PHECG use was related with improved 30-day survival, a 3rd of sufferers (usually girls, the aged and these with comorbidities) beneath EMS care didn’t obtain a PHECG.The general intention of the PHECG2 examine is to replace evidence on care and outcomes for sufferers eligible for PHECG, particularly addressing the following analysis questions: (1) Is there a distinction in 30-day mortality, and in reperfusion price, between those that do and those that don’t obtain PHECG? (2) Has the proportion of eligible sufferers who obtain PHECG modified since the introduction of main percutaneous coronary intervention networks? (3) Are sufferers that obtain PHECG totally different from these that don’t in phrases of social and demographic elements, or prehospital scientific presentation? (4) What elements affect EMS clinicians’ selections to carry out PHECG?This is an explanatory, mixed-method examine comprising 4 work packages (WPs). WP1 is a population-based, linked-data evaluation of a nationwide ACS registry (Myocardial Ischaemia National Audit Project). WP2 is a retrospective chart overview of affected person information from three giant regional EMS. WP3 contains focus teams of EMS personnel.
NOD1 antibody |
70R-13231 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal NOD1 antibody |
NOD1 Antibody |
32256-100ul |
SAB |
100ul |
EUR 252 |
NOD1 Antibody |
1-CSB-PA047815 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NOD1. Recognizes NOD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
NOD1 Antibody |
1-CSB-PA876477 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NOD1. Recognizes NOD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
NOD1 Antibody |
DF6378 |
Affbiotech |
200ul |
EUR 304 |
Description: NOD1 Antibody detects endogenous levels of total NOD1. |
NOD1 Antibody |
CSB-PA015914KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NOD1. Recognizes NOD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NOD1 Antibody |
CSB-PA015914KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NOD1. Recognizes NOD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NOD1 siRNA |
20-abx926109 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOD1 siRNA |
20-abx926110 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOD1 Rabbit pAb |
A1246-100ul |
Abclonal |
100 ul |
EUR 308 |
NOD1 Rabbit pAb |
A1246-200ul |
Abclonal |
200 ul |
EUR 459 |
NOD1 Rabbit pAb |
A1246-20ul |
Abclonal |
20 ul |
EUR 183 |
NOD1 Rabbit pAb |
A1246-50ul |
Abclonal |
50 ul |
EUR 223 |
NOD1 cloning plasmid |
CSB-CL896866HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2862
- Sequence: atggaagagcagggccacagtgagatggaaataatcccatcagagtctcacccccacattcaattactgaaaagcaatcgggaacttctggtcactcacatccgcaatactcagtgtctggtggacaacttgctgaagaatgactacttctcggccgaagatgcggagattgtgt
- Show more
|
Description: A cloning plasmid for the NOD1 gene. |
Polyclonal NOD1 Antibody |
APR03070G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOD1 . This antibody is tested and proven to work in the following applications: |
NOD1 Blocking Peptide |
DF6378-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse Nod1 Antibody |
abx030859-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Nod1 Antibody |
abx030859-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
NOD1 Conjugated Antibody |
C32256 |
SAB |
100ul |
EUR 397 |
Polyclonal NOD1 Antibody |
APR06661G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOD1 . This antibody is tested and proven to work in the following applications: |
Anti-NOD1 antibody |
STJ24778 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. |
Human NOD1 shRNA Plasmid |
20-abx957041 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NOD1 shRNA Plasmid |
20-abx979820 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-CARD4/NOD1 Antibody |
PB9294 |
BosterBio |
100ug/vial |
EUR 334 |
Polyclonal NOD1 Antibody (C-Terminus) |
APR02775G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOD1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal NOD1 Antibody (aa930-949) |
APR02826G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOD1 (aa930-949). This antibody is tested and proven to work in the following applications: |
Polyclonal NOD1 Antibody (C-term) |
APR03618G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOD1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Mouse Nod1 Antibody (Center) |
APR04406G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Nod1 (Center). This antibody is tested and proven to work in the following applications: |
Nod1 ORF Vector (Rat) (pORF) |
ORF071394 |
ABM |
1.0 ug DNA |
EUR 506 |
h NOD1 inducible lentiviral particles |
LVP751 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: h NOD1 (nucleotide-binding oligomerization domain containing 1), [alternative names: CARD4; CLR7.1; NLRC1]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_006092. It also contains a RFP-Blasticidin dual selection marker. |
NOD1 ORF Vector (Human) (pORF) |
ORF007140 |
ABM |
1.0 ug DNA |
EUR 95 |
Nod1 ORF Vector (Mouse) (pORF) |
ORF051497 |
ABM |
1.0 ug DNA |
EUR 506 |
Nod1 ORF Vector (Mouse) (pORF) |
ORF051498 |
ABM |
1.0 ug DNA |
EUR 506 |
NOD1 ELISA Kit (Human) (OKCA00743) |
OKCA00743 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Enhances caspase-9-mediated apoptosis. Induces NF-kappa-B activity via RIPK2 and IKK-gamma. Confers responsiveness to intracellular bacterial lipopolysaccharides (LPS). Forms an intracellular sensing system along with ARHGEF2 for the detection of microbial effectors during cell invasion by pathogens. Required for RHOA and RIPK2 dependent NF-kappa-B signaling pathway activation upon S.flexneri cell invasion. Involved not only in sensing peptidoglycan (PGN)-derived muropeptides but also in the activation of NF-kappa-B by Shigella effector proteins IpgB2 and OspB. Recruits NLRP10 to the cell membrane following bacterial infection.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
NOD1 ELISA Kit (Human) (OKEH08039) |
OKEH08039 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This gene encodes a member of the nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) family of proteins. The encoded protein plays a role in innate immunity by acting as a pattern-recognition receptor (PRR) that binds bacterial peptidoglycans and initiates inflammation. This protein has also been implicated in the immune response to viral and parasitic infection. Major structural features of this protein include an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. Mutations in this gene are associated with asthma, inflammatory bowel disease, Behcet disease and sarcoidosis in human patients.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
NOD1 ELISA Kit (Mouse) (OKEH08040) |
OKEH08040 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.096ng/mL |
Polyclonal NOD1 / CARD4 Antibody (C-Term) |
APG00381G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NOD1 / CARD4 (C-Term). This antibody is tested and proven to work in the following applications: |
Nod1 sgRNA CRISPR Lentivector set (Rat) |
K6741701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nod1 sgRNA CRISPR Lentivector set (Mouse) |
K3911101 |
ABM |
3 x 1.0 ug |
EUR 339 |
NOD1 sgRNA CRISPR Lentivector set (Human) |
K1438501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nod1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6741702 |
ABM |
1.0 ug DNA |
EUR 154 |
Nod1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6741703 |
ABM |
1.0 ug DNA |
EUR 154 |
Nod1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6741704 |
ABM |
1.0 ug DNA |
EUR 154 |
Nod1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3911102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nod1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3911103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nod1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3911104 |
ABM |
1.0 ug DNA |
EUR 154 |
NOD1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1438502 |
ABM |
1.0 ug DNA |
EUR 154 |
NOD1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1438503 |
ABM |
1.0 ug DNA |
EUR 154 |
NOD1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1438504 |
ABM |
1.0 ug DNA |
EUR 154 |
NOD1 Protein Vector (Mouse) (pPB-C-His) |
PV205986 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPB-N-His) |
PV205987 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPM-C-HA) |
PV205988 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPM-C-His) |
PV205989 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPB-C-His) |
PV205990 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPB-N-His) |
PV205991 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPM-C-HA) |
PV205992 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Mouse) (pPM-C-His) |
PV205993 |
ABM |
500 ng |
EUR 1065 |
NOD1 Protein Vector (Rat) (pPB-C-His) |
PV285574 |
ABM |
500 ng |
EUR 1191 |
NOD1 Protein Vector (Rat) (pPB-N-His) |
PV285575 |
ABM |
500 ng |
EUR 1191 |
NOD1 Protein Vector (Rat) (pPM-C-HA) |
PV285576 |
ABM |
500 ng |
EUR 1191 |
NOD1 Protein Vector (Rat) (pPM-C-His) |
PV285577 |
ABM |
500 ng |
EUR 1191 |
NOD1 Protein Vector (Human) (pPB-C-His) |
PV028557 |
ABM |
500 ng |
EUR 329 |
NOD1 Protein Vector (Human) (pPB-N-His) |
PV028558 |
ABM |
500 ng |
EUR 329 |
NOD1 Protein Vector (Human) (pPM-C-HA) |
PV028559 |
ABM |
500 ng |
EUR 329 |
NOD1 Protein Vector (Human) (pPM-C-His) |
PV028560 |
ABM |
500 ng |
EUR 329 |
Nod1 3'UTR Luciferase Stable Cell Line |
TU114190 |
ABM |
1.0 ml |
Ask for price |
Nod1 3'UTR GFP Stable Cell Line |
TU164190 |
ABM |
1.0 ml |
Ask for price |
Nod1 3'UTR Luciferase Stable Cell Line |
TU214064 |
ABM |
1.0 ml |
Ask for price |
Nod1 3'UTR GFP Stable Cell Line |
TU264064 |
ABM |
1.0 ml |
Ask for price |
NOD1 3'UTR GFP Stable Cell Line |
TU065800 |
ABM |
1.0 ml |
EUR 1521 |
NOD1 3'UTR Luciferase Stable Cell Line |
TU015800 |
ABM |
1.0 ml |
EUR 1521 |
Nod1 ELISA Kit| Mouse Nucleotide-binding oligomerization domain |
EF015735 |
Lifescience Market |
96 Tests |
EUR 689 |
NOD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV645613 |
ABM |
1.0 ug DNA |
EUR 1355 |
NOD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV645617 |
ABM |
1.0 ug DNA |
EUR 1355 |
NOD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV645618 |
ABM |
1.0 ug DNA |
EUR 1355 |
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
abx026454-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
abx026454-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Antibody |
20-abx212259 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Antibody |
20-abx212260 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Antibody |
20-abx104722 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
abx117079-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
abx038077-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
abx430272-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) Antibody |
20-abx001158 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Recombinant Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) |
4-RPK296Hu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9Y239
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Nucleotide Binding Oligomerization Domain Containing Protein 1 expressed in: E.coli |
Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Protein |
20-abx068373 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K6741705 |
ABM |
3 x 1.0 ug |
EUR 376 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3911105 |
ABM |
3 x 1.0 ug |
EUR 376 |
NOD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1438505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Human Nucleotide-binding oligomerization domain-containing protein 1(NOD1) ELISA kit |
CSB-EL015914HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Nucleotide-binding oligomerization domain-containing protein 1(NOD1) ELISA kit |
1-CSB-EL015914HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Nucleotide-binding oligomerization domain-containing protein 1(NOD1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Nod1/ Nucleotide-binding oligomerization domain-containing protein 1 ELISA Kit |
E1036Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) ELISA Kit |
abx555520-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
Human Nucleotide-Binding Oligomerization Domain-Containing Protein 1 (NOD1) ELISA Kit |
abx556317-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
NOD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV645614 |
ABM |
1.0 ug DNA |
EUR 1355 |
NOD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV645615 |
ABM |
1.0 ug DNA |
EUR 1413 |
NOD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV645616 |
ABM |
1.0 ug DNA |
EUR 1413 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6741706 |
ABM |
1.0 ug DNA |
EUR 167 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K6741707 |
ABM |
1.0 ug DNA |
EUR 167 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K6741708 |
ABM |
1.0 ug DNA |
EUR 167 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K3911106 |
ABM |
1.0 ug DNA |
EUR 167 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K3911107 |
ABM |
1.0 ug DNA |
EUR 167 |
Nod1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K3911108 |
ABM |
1.0 ug DNA |
EUR 167 |
NOD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1438506 |
ABM |
1.0 ug DNA |
EUR 167 |
NOD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1438507 |
ABM |
1.0 ug DNA |
EUR 167 |
NOD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1438508 |
ABM |
1.0 ug DNA |
EUR 167 |
Human Nod1 (Apaf-1 like protein/CARD4) Control/blocking peptide #1 |
NOD11-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
Rabbit Anti-Human Nod1 (Apaf-1 like protein/CARD4) antiserum #1 |
NOD11-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human) |
4-PAK296Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), APC |
4-PAK296Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with APC. |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), Biotinylated |
4-PAK296Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with Biotin. |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), Cy3 |
4-PAK296Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with Cy3. |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), FITC |
4-PAK296Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with FITC. |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), HRP |
4-PAK296Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with HRP. |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), PE |
4-PAK296Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with PE. |
Rabbit Anti-Human Nod1 (Apaf-1 like protein/CARD4) IgG #1, aff pure |
NOD11-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAK296Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOD1 (Ala612~Asp826)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nucleotide Binding Oligomerization Domain Containing Protein 1 (NOD1). This antibody is labeled with APC-Cy7. |
WP4 will synthesise findings from WP1-Three to tell the growth of an intervention to extend PHECG uptake.The examine has been accepted by the London-Hampstead Research Ethics Committee (ref: 18LO1679). Findings shall be disseminated via suggestions to collaborating EMS, convention displays and publication in peer-reviewed journals.NCT03699137.